Complementary Base Pair Chain

Problem Description

Deoxyribonucleic acid (DNA) is formed by two complementary base chains joined in a double helix. There are $4$ kinds of bases: adenine (A), guanine (G), thymine (T), and cytosine (C). On the corresponding positions of the two complementary chains, adenine always pairs with thymine, and guanine always pairs with cytosine. Your task is, given the base sequence of one single chain, to output the base sequence of its complementary chain.

Input Format

A string representing one base chain. The string contains only the uppercase letters A, T, G, C, denoting adenine, thymine, guanine, and cytosine respectively. The string length does not exceed $255$.

Output Format

A string containing only the uppercase letters A, T, G, C, representing the base chain complementary to the input.

Sample Input

ATATGGATGGTGTTTGGCTCTG

Sample Output

TATACCTACCACAAACCGAGAC